EST details — SGN-E201810

Search information 
Request: 201810Match: SGN-E201810
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1149Clone name: cLEC-11-B12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173009 is on microarray TOM1: SGN-S1-1-2.1.20.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173009 [TUS-15-A7] Trace: SGN-T188469 EST: SGN-E374825 Direction: 3' Facility: INRA
Clone: SGN-C173009 [TUS-15-A7] Trace: SGN-T188470 EST: SGN-E374826 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201810Length: 431 bp (824 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201810 [] (trimmed) ATTAATTGTTCCTTGGAACAGCTAATATCTCCTTACACCAACTCCCCATGGCAACCATCACTTTACTTTTCTTTCTCTTCTTACAACTCATAACC
GCCACTATTGCTACCACGTCGCCACCGTATAACGCCACAGTCTTCGTCTTGCTTAACTGTGGCGCACAATCAGCCATCACCGATGATACTGGCCG
TCGATGGGATACTGATACTCACTTTCCAAATTTCTTACCTTCCGACTTTTCAAGCATATCCACAACAGCCACAGCTCTTGAACAAGATCCTTCTG
TCAATAGAATTCCTTATACGACTGGTATTCGTATTATGAGATCTCAATTCACCTATACTTTCCGTGTTACCCCTGGCACAATATTCCTCCGTCTC
TATTTCTACCCTGCCAATTACTCCGGTTTTAACAAAGCTGATTCTTTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201810] SGN-U566101 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25757 [Download][View] Facility Assigned ID: TCABR06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0124 Quality Trim Threshold: 14.5