Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E204236

Search information 
Request: 204236Match: SGN-E204236
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1725Clone name: cLEC-13-L13
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173151 is on microarray TOM1: SGN-S1-1-4.3.20.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173151 [TUS-15-G5] Trace: SGN-T188496 EST: SGN-E374852 Direction: 3' Facility: INRA
Clone: SGN-C173151 [TUS-15-G5] Trace: SGN-T188497 EST: SGN-E374853 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204236Length: 480 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204236 [] (trimmed) GCAGCACCAGGTCAAACTGAGTACAACCTGTAGGCTGCAGTAAAGTTCAAATTAGTGACTACCTGTTGGCTGAAATCTCACATTTAAATTTTAAA
AGGGCATGAGCAATGGATATGGTGGCAATCGGTTTATAAACTTACAAATTTTTTATATTTCCTCCTTATGCACACACTATTTATCAAGATTTTCA
GTTGCATTTTTACCACTTCGATAGTTGTGCAAATTAAAATTGCTGAAAAACAAGTCAAGGTGTGTATAAGAGCTCACCTGGATGACTATGACAAT
CAAACAATACTTTATACGGCTATTATGCAGAATATATTCTGGTGAGATCATGAGACTAATTTATATGCAATAACTAAAACGTATATTCAGTAACA
TCGGAAGGGAAGCTAAAGGAGATCCACTGTTGATATGGCTCAACTTTATCTTTTGAGTCTTTTGATTGATGAAGTGCACGATGATGCTTCTATTT
TCTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204236] SGN-U573170 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25989 [Download][View] Facility Assigned ID: TCABY67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0192 Quality Trim Threshold: 14.5