EST details — SGN-E368792

Search information 
Request: 368792Match: SGN-E368792
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177333Clone name: TUS-26-E11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177333 is on microarray TOM1 spot ID 1-1-6.1.7.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C37217 [cLEG-41-G20] Trace: SGN-T71921 EST: SGN-E258889 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E368792Length: 205 bp (948 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E368792 [] (trimmed) ATGCATATATATCAAAAACCAATATCCTACAAACATCCATTTACCAAAAAAACAAAGAAATCAACAAGCAAAGAAACAGGGTAAAGAAAAATCAA
ATCAAAGTGTTAATCAGAAAGTCCATTTCCAGATTTTGATTCGAAGATCCACTTTGCATTTCACATTTGAAGTAGTAGCTTTACTCGGAGTTTTG
CCGGAAGGAACAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E368792] SGN-U566344 Tomato 200607 Build 2 81 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T182202 [Download][View] Facility Assigned ID: FA0AAD14AC06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.870 Expected Error Rate: 0.0184 Quality Trim Threshold: 14.5