EST details — SGN-E392918

Search information 
Request: 392918Match: SGN-E392918
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181687Clone name: TUS-37-J21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181687 is on microarray TOM1 spot ID 1-1-4.2.12.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C147963 [cTOF-6-K22] Trace: SGN-T154111 EST: SGN-E339012 Direction: 5' Facility: TIGR
Clone: SGN-C181687 [TUS-37-J21] Trace: SGN-T194056 EST: SGN-E392730 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392918Length: 343 bp (875 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392918 [] (trimmed) AGTACTCTACAATTTCCATTATACAAAAACATTCTAAAATGTGTTATTTTGCCAATAAGACAAATAAGAACTGAAAATTTTTAACAAGCAGCAAT
GCTTACAACAGCAAATTGCTTTTATTATTGATGCAATGTGCATACAGAGAAACCAATTTTTGACAAGAAGAAAAAAATAATACTTCTACAACAGC
TTGACCAATATGAAGCAAAAAACACAAATTGCTCTCGTCTCGCGTCTAGTCATGCATCTTCACTTTGCCATCCTTCACTAAAAGGTTATTTACAT
GGCGAGTCAACATAGACATCTAAATCGAGGTCTGAATGAACGTAGAGACCTCTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392918] SGN-U570737 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194244 [Download][View] Facility Assigned ID: FA0AAD25CE11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5