EST details — SGN-E394966

Search information 
Request: 394966Match: SGN-E394966
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180464Clone name: TUS-34-G22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180464 is on microarray TOM1 spot ID 1-1-3.3.19.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C30208 [cLEF-56-N20] Trace: SGN-T63708 EST: SGN-E249579 Direction: 5' Facility: TIGR
Clone: SGN-C180464 [TUS-34-G22] Trace: SGN-T196293 EST: SGN-E394967 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394966Length: 225 bp (853 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394966 [] (trimmed) CCTTTCCAACCTTATACAGGAGTATTAGGAATTAGGAATTACGGTAGTACAATCATTTAATTTCCAACTACTTTTCAATCTCTCGCCTTTCAAAT
TTCCGGTGAGTAATTAAAAAACTACACCCATTACATTCATAATTTTAAAAAAAAACAACCCTACCATCCATAATTAATATAAATTCATTACCCGC
CACCTACCCTTCATTTGCTTCTTTTATTTTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394966] SGN-U588354 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196292 [Download][View] Facility Assigned ID: FA0AAD22BD11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.850 Expected Error Rate: 0.0191 Quality Trim Threshold: 14.5