EST details — SGN-E395055
| Search information |
| Request: 395055 | Match: SGN-E395055 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C180805 | Clone name: TUS-35-F3 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C180805 is on microarray TOM1 spot ID 1-1-6.2.17.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C65482 [cLEN-10-E8] | Trace: SGN-T89387 | EST: SGN-E275515 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C180805 [TUS-35-F3] | Trace: SGN-T196382 | EST: SGN-E395056 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E395055 | Length: 110 bp (955 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E395055 [] (trimmed)
AAGAAAACAGGAATTTTATATCAACGACGAAAGAGAAATATACTCTCCAATGTATATTGTAGACCTGACATGTACATCTTAATTCCAACGAGTTC
GAACAAGCTAAGGAT
GAACAAGCTAAGGAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E395055] | SGN-U576627 | Tomato 200607 | Build 2 | 18 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T196381 [Download][View] | Facility Assigned ID: FA0AAD23CC02FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.902 | Expected Error Rate: 0.0051 | Quality Trim Threshold: 14.5 |
Working
