EST details — SGN-E396227

Search information 
Request: 396227Match: SGN-E396227
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180554Clone name: TUS-34-K16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180554 is on microarray TOM1 spot ID 1-1-1.3.19.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C39422 [cLEG-4-A14] Trace: SGN-T64572 EST: SGN-E249958 Direction: 5' Facility: TIGR
Clone: SGN-C180554 [TUS-34-K16] Trace: SGN-T199702 EST: SGN-E398376 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396227Length: 367 bp (863 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396227 [] (trimmed) ACAGAAAGAGACTAATAACCAGATAGATTATCATATGGCTGGTCATAGAAAAGCTTAAAATGCCTCACAACTTTAGATACATGATCCACAGTTGA
GCTAAACTACAATCGATACGATCGATCCGAAAAACCAGAAACTGTATAGAACCATTTACAAAAAATTAAGCCACCAACCAATTTAGCGATAACTA
ACTATACTTTCAGGGCATCCCCACAATGAAGGAAGATGCATATATCTAGTTTACAATGGCTCTCGCCAAATACGCCCAGCTACCTTTAGCTTCAG
CTCCTTCCTGTCACCACCAGAGAAGAAGAGTGCCTTGCCCCTTTGAATAATCAGCCCGTCAAAACGGTCTCGGACAGTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396227] SGN-U577526 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197553 [Download][View] Facility Assigned ID: FA0AAD22BF08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5