EST details — SGN-E396639

Search information 
Request: 396639Match: SGN-E396639
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183984Clone name: TUS-43-J14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183984 is on microarray TOM1 spot ID 1-1-3.2.18.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C20403 [cLED-2-G19] Trace: SGN-T48670 EST: SGN-E228022 Direction: 5' Facility: TIGR
Clone: SGN-C183984 [TUS-43-J14] Trace: SGN-T198116 EST: SGN-E396790 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396639Length: 383 bp (877 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E396639 [] (trimmed) CAGGTAAAGCTAAGTCAACAATATAGGGACGAGGTCTATAACAACGAGCACAAAAACAACAACAACAATAGTAACGTTTGGGATCATAGTGCAAA
ATACAAAGCGGATATTTTAAACCATCATTTATCGGAATTACTTCTTTCTGCACAGGTGGCTTGCCTGAAAATCGCGACTCCAGTGGACAAGTTAC
AGAGGATCGACAAGCAATTGACGGATTCACAGAATTTGGTGGCAAGGTACTATGTTGCTGGTCGAAGTCAGACGGTCTCGTGATGATAAAGAACT
TGATCACTTTATGGCGAATTATGTTCTATTGCTCTCTTCTTTTACAGAGACCCTACTACTCCTTGTTCTTGTCCATGCAAAGAAAGCTGTCATGA
CTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396639] SGN-U571927 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197965 [Download][View] Facility Assigned ID: FA0AAD31DE07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0330 Quality Trim Threshold: 14.5