EST details — SGN-E399100

Search information 
Request: 399100Match: SGN-E399100
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172960Clone name: TUS-14-O6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172960 is on microarray TOM1 spot ID 1-1-3.3.20.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14372 [cLEC-7-L16] Trace: SGN-T25351 EST: SGN-E202069 Direction: 5' Facility: TIGR
Clone: SGN-C172960 [TUS-14-O6] Trace: SGN-T195409 EST: SGN-E394083 Direction: 3' Facility: INRA
Clone: SGN-C172960 [TUS-14-O6] Trace: SGN-T195702 EST: SGN-E394376 Direction: 5' Facility: INRA
Clone: SGN-C172960 [TUS-14-O6] Trace: SGN-T195702 EST: SGN-E399101 Direction: 5' Facility: INRA
Clone: SGN-C172960 [TUS-14-O6] Trace: SGN-T199533 EST: SGN-E398207 Direction: 3' Facility: INRA
Clone: SGN-C172960 [TUS-14-O6] Trace: SGN-T199557 EST: SGN-E398231 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399100Length: 574 bp (863 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399100 [] (trimmed) AGATGAAAACACACAACCTCTTTATTAGAAAATAGCAACAAAATTACAATGAAAATTAAAGAGGCAAGCCACACCATATATTAAACATAAGTGAT
GAGAAACACTATTCTCAATTATTGATGAATTTAGTAAATATAAAATTATGACTAAAGATGTAACAAATCTAGAAATAATTTTTTGGGACAAGGCA
AAGATCATTTTTCTTATGCATAGTAATTCCAGGCATGACATTTGTGTCAATATCTTCTTTCTTCATCCCACAAGGCAATTCCCAATCAAATGCAT
AGAGAAGGTTTGAAAGCATAAGATCCACCGTCGCAACACCAAGTGCAATACCTGGGCAACCTCTTCGTCCTGCACCAAATGGAAGCAACTCAAAA
TCTTGGCCTTTGAAATCAATGTCACTATTCAAGAATCTCTCGGGCATAAATTCTTCTGGATTTTCCCATACTTCAGGATCCCTTGCAAGAGGCCA
CGAGTTCACATGAATTATAGTTCCTAGCTGAATTTCATACCCTTCTAGTGTGGGATTTTCTTCATTGTTTCTCTTGGTACTAAGGATTGGAGCTG
GTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399100] SGN-U582228 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195409 [Download][View] Facility Assigned ID: FA0AAD2BH03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5