EST details — SGN-E1297476

Search information 
Request: 1297476Match: SGN-E1297476
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C970091Clone name: 6L9
nocartOrdering Not Available
Library Name: Sl_RootSSH02Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U582049 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1297476Length: 313 bp (313 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1297476 [] (trimmed) ACGGTAGTGGTGGGACCCTATCTCATGAGCAACTAATTGAAGTTGCAGCAGGGTTGGAAATGAGTGAACAAAGGTTCTTGTGGGTAGTTAGATGC
CCTAATGACAAAATAGCTAACGCTACTTTTTTTAATGTCCAAGATTCAACGAACCCTCTTGAGTTTTTACCAAAAGGGTTCTTGGAAAGGACCAA
AGGGTTTGGTTTAGTGTTGCCTAATTGGGCCCCACAAGCTCGAATATTGAGCCATGAGTCGACGGGTGGATTCTTGACTCATTGTGGATGGAACT
CGACTCTTGAGAGTGTAGTCCATGGGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1297476] SGN-U582049 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1028079 [Download][View] Facility Assigned ID: DY523902
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: