EST details — SGN-E1334443

Search information 
Request: 1334443Match: SGN-E1334443
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1056492Clone name: CACAT36FLBUD_Q2_11_G22_343.F
nocartOrdering Not Available
Library Name: Ca_FlowBudOrganism: Coffea arabica

Tissue: Buds
Development Stage: flower buds

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1334443Length: 310 bp (310 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1334443 [] (trimmed) GGACAGTGGGTCCAGCGTAAGGGCAGCTCCAAAACGGGGCAACAGCTGTGGAACGTCATATCACTGACGGTCTGCTTCGTACCAGATCATGGCCT
TTGGCATTTTGTGGTAGAAAAAAAAATTATATATATGGCCTATGATTATGTACTTAATTCTTCAATTAGTAGGTGCAAATTTTAGACTAAAGGGG
AACTAACTGTCAATTTGGGGGGTAGATTAGGCAAAGTGCCACAGCTAATTTGGCTCTTTTTGGACTTTTTCCGTTGTTCGGTGGTGCAAGGAGGA
TTCCTAATTGCTTTGGTAACAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1334443] SGN-U609930 Coffea arabica Build 1 1 ESTs assembled
[SGN-E1334443] SGN-U629642 Coffee species Build 1 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1065115 [Download][View] Facility Assigned ID: GR983175
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: