EST details — SGN-E200394

Search information 
Request: 200394Match: SGN-E200394
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3213Clone name: cLEC-1-I1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3213 [cLEC-1-I1] Trace: SGN-T24606 EST: SGN-E200393 Direction: 5' Facility: TIGR
Clone: SGN-C186447 [TUS-50-A5] Trace: SGN-T351557 EST: SGN-E550682 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200394Length: 327 bp (976 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E200394 [] (trimmed) TTTATAGAATGGTGTGGTTGCTCATTACTAATTTTCACCACTTAGGAACTAAGAAAACAAACAAAAAGGGAAACTCAACAATCTTCTCATGTTGG
AACCTCATGTGAAAATTTACAAAGCTGAGGCCCTTATGGAAGATGCAGGAGGCTTATTGAAATACAATAGGGAAACAGAAAATAACAACAGGAAT
GAAGACAAAGATAAAGGACTTTTTTCTTTTCTTCTTTATATTGGAGGTAGTTAAAGTGAGGGCCAAATGAACCTAAGCCTGCTGGCCCCAATTAG
CCCAGTTGGCAGAACTTCCAACTCTTGGCATGCTATTCACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200394] SGN-U564627 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24607 [Download][View] Facility Assigned ID: TCAAA49TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.896 Expected Error Rate: 0.0026 Quality Trim Threshold: 20.5