EST details — SGN-E200656

Search information 
Request: 200656Match: SGN-E200656
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14964Clone name: cLEC-9-M22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
See unigene SGN-U582049 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200656Length: 313 bp (443 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E200656 [] (trimmed) GGCTGGATGAACAGCCGCGTGGCTCTGTGTTATACATATTGTACGGTAGTGGTGGGACCCTATCTTATGAGCAACTCATTGAAGTTGCACCAGGG
TTGGAAATGAGTGCACAAAGGTTCTTGTGGGTTGTTAGATGCCCTAATGACAAAATAGCTAACGCTTCTTTTTTTAATGTCCAAGATTCAACGAA
CCCTCTTGAGTTTTTACCAAAAGGGTTCTTGGAAAGGACCAAAGGGTTTGGTTTAGTGTTGCCTAATTGGGCCCCACAAGCTGGAATATTGAGCC
ATGAGTCGACTGGTGAGATTCTTGACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200656] SGN-U582049 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24950 [Download][View] Facility Assigned ID: TCABH83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0232 Quality Trim Threshold: 14.5