EST details — SGN-E203398

Search information 
Request: 203398Match: SGN-E203398
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C436Clone name: cLEB-3-H14
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: Alias clone SGN-C182247 is on microarray TOM1: SGN-S1-1-4.2.8.13
See unigene SGN-U577253 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C436 [cLEB-3-H14] Trace: SGN-T23145 EST: SGN-E203399 Direction: 3' Facility: TIGR
Clone: SGN-C182247 [TUS-39-B5] Trace: SGN-T195282 EST: SGN-E393956 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203398Length: 539 bp (672 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203398 [] (trimmed) TTAAAACCCCATCAACTCCTACTCCCCTTTTCTTGATTCCAAATTTTCAATCACAAAAGCAACAACAAGAAGCATATTAATAAACAATGGCCACT
GTTACCTCTGCTGCTGTTGCTATTCCATCTTTCACTGGCCTTAAGGCTGGTGCTTCATCATCTTCCAGAGTTAGCACCGGTGCATCCGCTAAGGT
GGCAGCTGCCCCAGTTGCCAGATTGACTGTGAAGGCGTCTTTGAAAGATGTCGGTGCTGTGGTTGCTGCCACCGCTGTTAGCGCGATGCTTGCTA
GCAATGCCATGGCACTTGAAGTGTTGCTTGGTGGTGATGATGGGAGTCTAGCTTTTATTCCTGGGAACTTCAGCGTTAGTGCTGGTGAGAAAATT
ACATTCAAGAACAATGCAGGGTTCCCACACAACGTCGTATTTGATGAAGATGAAATCCCAGCTGGTGTGGATGCTAGTAAGATTTCCATGTCTGA
AGAGGATCTTCTGAATGCAGCAAGAGAGACATACAGTGTCACTTTGAGTGAGAAAGGAACTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203398] SGN-U577253 Tomato 200607 Build 2 198 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23144 [Download][View] Facility Assigned ID: TSHAL43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5