EST details — SGN-E219532

Search information 
Request: 219532Match: SGN-E219532
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C50339Clone name: cLEL-11-D13
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E219532Length: 308 bp (644 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E219532 [] (trimmed) ACATACTCAAAAATATGCGAAAATATGTTCATAGAAAAAAAAATTAAACTTAGGCTCTGTAGGAGCTGGTTGATTCACTGACTTTGCATTCATTC
AACCTTAATAATTGCCCAAGACCAAAAATTTATCTAGCAGAAAAATAATTATCATCAATTGCTTTTTTAATTCTGCAAACAGCTAAAATAGTTAT
AAAATGTTTTAATCTAACAAAACGATAGATGGTTCGATTGATGAACTCAGCCATCGAACCCGGTCTGGCTCCACACAGTATGTTGGACCCGGCTC
AAGTTCCGACCCTTTAACGCACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E219532] SGN-U579930 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T4549 [Download][View] Facility Assigned ID: cC-esflcLEL11D13d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0266 Quality Trim Threshold: 14.5