EST details — SGN-E238657

Search information 
Request: 238657Match: SGN-E238657
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61007Clone name: cLEL-9-J19
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238657Length: 156 bp (950 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E238657 [] (trimmed) CTGCGTGGAACTCTCTTTTTCTTGTCATAGTAGAAACAACACCATTACAGAAGACAATGAAAATAGGTATAAGGTAGTGGAAAAATGGATTGTTG
AAGCATGGCCTGTTAATTGCACGGACCCTGAAAACATTCCAGCAGTATTGGTTCTCGTGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238657] SGN-U565041 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T19503 [Download][View] Facility Assigned ID: cC-esflcLEL9J19d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0024 Quality Trim Threshold: 12.5