EST details — SGN-E243344

Search information 
Request: 243344Match: SGN-E243344
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C25729Clone name: cLEF-16-B22
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243344Length: 317 bp (1158 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E243344 [] (trimmed) GTTCAGACAAAAAACCCTAACCCCCAATCGCTTCTCTTTCCCTCAGATCTTTTACTCTTCTTTATCAGTCATGGCTGGCTTGGCACCGGAAGGTT
CTCAATTTGATGCTCGTCAATTTGATGCTAAAATGACAGAGCTGCTTGGGACTGAACAGCAGGAGTTCTTTACATCATATGATGAAGTTCATGAC
AGTTTCGATGCCATGGGTTTGCAAGAAAATCTTCTTAGGGGCATCTATGCCTATGGTTTTGAGAAGCCATCTGCTATCCAGCAAAGGGGTATTGT
TCCTTTTTGCAAGGGTCTTGATGTGATTCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243344] SGN-U578301 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T59765 [Download][View] Facility Assigned ID: TMGCL11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0172 Quality Trim Threshold: 14.5