EST details — SGN-E247419

Search information 
Request: 247419Match: SGN-E247419
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28070Clone name: cLEF-46-H20
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176876 is on microarray TOM1: SGN-S1-1-7.2.8.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176876 [TUS-25-B10] Trace: SGN-T182103 EST: SGN-E369614 Direction: 3' Facility: INRA
Clone: SGN-C176876 [TUS-25-B10] Trace: SGN-T182104 EST: SGN-E369615 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247419Length: 570 bp (945 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247419 [] (trimmed) ATCAAATTCTGGTAGAACTGGCAGACAAAGTATAGGATCTGAACATAGCTTTGATAAATCACCGCTGCATCCACATTACCAGGCAAAGGTTAGTA
ATGCTGGAAGAGGTGTTGCATCTCCTGCTTGGGAAGGAAAGAACAATTCTTATGATAGCAGTCACGGTACTCCTGGAAGGTCCAAAGTTAAGCAA
GACAACTCTGATAGAGGAGCTGCAGTTCCAAGATTCGGAGAGTGGGACGAGAATGATCCTCAATCTGCTGATAACTACACACACATTTTCAACAA
AGTCCGAGAGGAAAAGCAAGGAAATCCATCAGGGACACCTAGTAGAACATCGAACAATACACAAAAGCATAACTCAGAGGAAAAGCAAAGGAAGT
GGTGTTGTTGTCCCTGGTAATTATGCAAGGGAGGACCTTGATTTTATTCCAAAACAGCCAAGGGATGTGTAAATAGTTCAACAAATTACTTGTGC
AATATATTAGAGTAATTCATTTATACTTTGTTCCCACAGAATTCTGCAATTGTATTGTCAACTTGTAGTCTTTAATATTGTACTTGTGTTTGTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247419] SGN-U579628 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61830 [Download] [View] Facility Assigned ID: TMGHB46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0149 Quality Trim Threshold: 12.5