EST details — SGN-E258392

Search information 
Request: 258392Match: SGN-E258392
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C38900Clone name: cLEG-47-M17
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E258392Length: 405 bp (842 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E258392 [] (trimmed) CTAAAAAAATTGGGTCGCCGGAAAATCAAGATTCCGGTAACCCATAGTAATTATTTTGTTTATACATAGAAATTTTTTCTTTTCTGTCGCCTGGA
GATTAAAAAAAGGTGATGATAAATGGCAAAGGGTCGGAAACTGGCCACGAGTCGCAGTGAAATGTTATTAGGAAACTACCCAAGCTATAGAAATG
GAACTGCAACAGTCAACGGTTCCTCCGAACTAGGAGAAAATGATGTCTGGGCAACGGTTGATGACATGGATGATCACGATTCAAGGGGCGAGTGG
AGTCCACGCGCCGCCGCTGAGGGTAACAACGGATACGTGAACCGTAAGGTCCAACAATCCGACCACCACCACCACAGCCACCGCGGGCGCCAGGT
TGGGGGCTTGTCATTGGCTTTCGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E258392] SGN-U579930 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T73562 [Download][View] Facility Assigned ID: TBFHC81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5