EST details — SGN-E268424

Search information 
Request: 268424Match: SGN-E268424
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C46835Clone name: cLEI-13-N19
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177647 is on microarray TOM1: SGN-S1-1-4.2.6.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268424Length: 472 bp (926 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E268424 [] (trimmed) TTCAGACAAAAAACCCTAACCCCCAATCGCTTCTCTTTCCCTCAGATCTTTTACTCTTCTTTATCAGTCATGGCTGGCTTGGCACCGGAAGGTTC
TCAATTTGATGCTCGTCAATTTGATGCTAAAATGACAGAGCTGCTTGGGACTGAACAGCAGGAGTTCTTTACATCATATGATGAAGTTCATGACA
GTTTCGATGCCATGGGTTTGCAAGAAAATCTTCTTAGGGGCATCTATGCCTATGGTTTTGAGAAGCCATCTGCTATCCAGCAAAGGGGTATTGTT
CCTTTTTGCAAGGGTCTTGATGTGATTCAACAGGCACAATCTGGTACAGGAAAGACAGCAACTTTCTGCTCTGGGATTCTCCAGCAGCTTGATTA
CAGCTTAGTCGAATGTCAGGCTCTGGTTCTGGCTCCAACCCGTGAGCTTGCCCAACAGATTGAGAAGGTTATGCGAGCACTTGGTGACTATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268424] SGN-U578301 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T82485 [Download][View] Facility Assigned ID: TGSBY82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5