EST details — SGN-E270496

Search information 
Request: 270496Match: SGN-E270496
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67623Clone name: cLEN-1-C7
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67623 [cLEN-1-C7] Trace: SGN-T87800 EST: SGN-E270495 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270496Length: 435 bp (833 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E270496 [] (trimmed) AGCTGATAAAAATATTATCCAATTCAAGTTCCAAGTATGATACAAGTCATCAACACAGGAAAAAAAAACCTATACAAGGCATCACAAACAGAAAC
TATCACACAATACAGATGAACGAACATATTGTCGTCAAAAGCGTTCCCATACAACAAAACGAAAAAAAAAGAAGAAGAAAAAAGGCCAAGGATTA
AAATGAAATATACTAAATTCAAAGACATCCAAAACCTGAAGTTGTTGTGGACTTACAATACAAAAAGACAAAACCAACAAAATTTGTAAATAAGT
CCAACTAAATTGGAAAACTACAATTCCCACGGCGAATCACAGAAACTGCAGTTTCCAAGTTTTAGTCCACTGCGGCTCTAACTAACCTAACAATA
AAATATTAAATTACTTAATATAACGAAAAATTCACCTCACAGAACCAAAATCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270496] SGN-U578301 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T87801 [Download][View] Facility Assigned ID: TRRAA16TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.899 Expected Error Rate: 0.0150 Quality Trim Threshold: 14.5