EST details — SGN-E272829

Search information 
Request: 272829Match: SGN-E272829
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C63512Clone name: cLEM-25-O11
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272829Length: 309 bp (545 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E272829 [] (trimmed) AAAATCAAAATTCCGGTAACCCATAGTAATTATTTTGTTTATACCATAGAAATTTTTTCTTTTCTGTCGCCTGGAGAATAAAAAAAGGTGATGAT
AAATGGCAAAGGGTCGGAAACCTGGCCACGAGTCGCAGTGAAATGTTATTAGGAAACTACCCAAGCTATAGAAATGGAACTGCAACCAGTCAACG
GTTCCTCCGAACTAGGAGAAGATGATGTCTGGGCAACGGTTGATGACATGGATGATCACCGATTCAAGGGGCGAGTGGAGTCCACCCCCCCCCCC
TGAGGGTAACCAACCGGATACCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272829] SGN-U579930 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T87544 [Download][View] Facility Assigned ID: TGFDS90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0340 Quality Trim Threshold: 14.5