EST details — SGN-E290578
| Search information |
| Request: 290578 | Match: SGN-E290578 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C77286 | Clone name: cLES-20-H7 |
| ||
| Library Name: cLES | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: This clone is not found on any microarray
See unigene SGN-U577253 for alternative clones/ESTs which are mapped
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E290578 | Length: 256 bp (1082 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E290578 [] (trimmed)
CAACAACAAGAAGCATATTAATAAACAATGGCCACTGTTACCTCTGCTGCTGTTGCTATTCCATCTTTCACTGGCCTTAAGGCTGGTGCTTCATC
ATCTTCCAGAGTTAGCACCGGTGCATCCGCTAAGGTGGCAGCTGCCCCAGTTGCCAGATTGACTGTGAAGGCGTCTTTGAAAGATGTCGGTGCTG
TGGTTGCTGCCACCGCTGTTAGCGCGATGCTTGCTAGCAATGCCATGGCACTTGAAGTGTTGCTTG
ATCTTCCAGAGTTAGCACCGGTGCATCCGCTAAGGTGGCAGCTGCCCCAGTTGCCAGATTGACTGTGAAGGCGTCTTTGAAAGATGTCGGTGCTG
TGGTTGCTGCCACCGCTGTTAGCGCGATGCTTGCTAGCAATGCCATGGCACTTGAAGTGTTGCTTG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E290578] | SGN-U577253 | Tomato 200607 | Build 2 | 198 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T102257 [Download][View] | Facility Assigned ID: TPSDA40TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.963 | Expected Error Rate: 0.0041 | Quality Trim Threshold: 14.5 |
Working
