EST details — SGN-E301232

Search information 
Request: 301232Match: SGN-E301232
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90864Clone name: cLEW-24-I1
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191913 [TUS-64-D23] Trace: SGN-T343647 EST: SGN-E542772 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191913 [TUS-64-D23] Trace: SGN-T343648 EST: SGN-E542773 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E301232Length: 423 bp (743 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E301232 [] (trimmed) GTTTTAATATTTTCGCAGATGACACGGCTACTGGACATCCTTGAAGATTACCTGATGTATCGAGGTCACCAGTATTGTCGGATTGATGGAAACAC
TGGTGGAGAAGATCGTGATGCTTCTATTGAAGCATATAACAGACCAGGGAGTGAAAAATTTGCCTTCTTATTGTCAACCAGAGCTGGTGGTCTTG
GTATCAATCTTGCTACGGCAGATATTGTTATTCTTTATGACAGTGACTGGAATCCACAGGTTGATTTGCAGGCTCAGGACCGCGCCCATAGGATT
GGACAGAAGAAGGAAGTCCAAGTATTCCGTTTCTGCACTGAGTATACAATTGAGGAGAAAGTGATTGAAAGGGCTTATAAGAAGCTGGCACTTGA
TGCACTGGTCATCCAACAGGGACGACTGGCTGAGCAAAAAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E301232] SGN-U565631 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114355 [Download][View] Facility Assigned ID: TRDDO49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5