EST details — SGN-E323963

Search information 
Request: 323963Match: SGN-E323963
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C127958Clone name: cTOC-3-M20
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: This clone is not found on any microarray
See unigene SGN-U582049 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E323963Length: 467 bp (935 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E323963 [] (trimmed) GCTTTCACAACTTTAGCAATTTCCAATCTTCCCACTATGCCATTTTCTTCATTCACTTTTGGCCTTAGTGCCACTTTTATATCCTCACTTAACAT
GACCGCGTTCATTTTTTGTTCCGCATAGAGTGGCCATGCTATAAGTGGTACCCCATGGACTACACTCTCAAGAGTCGAGTTCCATCCACAATGAG
TCAAGAATCCACCCGTCGACTCATGGCTCAATATTCGAGCTTGTGGGGCCCAATTAGGCAACACTAAACCAAACCCTTTGGTCCTTTCCAAGAAC
CCTTTTGGTAAAAACTCAAGAGGGTTCGTTGAATCTTGGACATTAAAAAAAGTAGCGTTAGCTATTTTGTCATTAGGGCATCTAACTACCCACAA
GAACCTTTGTTCACTCATTTCCAACCCTGCTGCAACTTCAATTAGTTGCTCATGAGATAGGGTCCCACCACTACCGTACGATATGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E323963] SGN-U582049 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T136536 [Download][View] Facility Assigned ID: TFCAJ82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5