EST details — SGN-E353470

Search information 
Request: 353470Match: SGN-E353470
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C161404Clone name: cTOS-15-I15
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E353470Length: 395 bp (903 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E353470 [] (trimmed) GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCCCGAGTCTGTCCGTGGGCTCTTGAATCTCCGTTTATGGATCACGATT
ATTACCAATGCTGGATTGGCTTGAAGTCTCACTTCTCAGGACTATCTATGAACGAAGACAACGTCGATTTGCAGAAAGGAAAACCCATAGAAAGG
TGAAATGCTCATTGTTCAGCTAGCTCCTGTAGTTCCTCCTAAAGTGACTTAAACTTGTACATAAGGAGTCACAGGCATGTAAAACATGAAATAAA
CCCTATGTTAGTATCAGATTGAAAGTTTAGGGTGGCGATCCAAGCGCGGATATAGTGGTAAGATGAAACCAATGTTCTATGAAATTGCGACGCAA
GTAAAAATGTGTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E353470] SGN-U566282 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T166420 [Download][View] Facility Assigned ID: TSCCE56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0