EST details — SGN-E380062

Search information 
Request: 380062Match: SGN-E380062
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C168641Clone name: TUS-3-K7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5995 [cLEC-33-P18] Trace: SGN-T30301 EST: SGN-E207029 Direction: 5' Facility: TIGR
Clone: SGN-C168641 [TUS-3-K7] Trace: SGN-T587 EST: SGN-E379948 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E380062Length: 735 bp (794 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E380062 [] (trimmed) GACTTCACACATATTCCATTGAGAAAGAATAAAAAATCTGCAAGCACTGTTTGTAACATACAAACACAAGTACAACATTAAAGACTACAAGTTGA
CAATACAATTGCAGAATTCTGTGGGAACAAAGTATAAATGAATTACTCTAATATATTGCACAAGTAATTTGTTGAACTATTTACACATCCCTTGG
CTGTTTTGGAATAAAATCAAGGTCCTCCCTTGCATAATTACCAGGGACAACAACACCACTTCCTTTGCTTTTCCTCTGAGTTATGCTTTTGTGTA
TTGTTCGATGTTCTACTAGGTGTCCCTGATGGATTTCCTTGCTTTTCCTCTCGGACTTTGTTGAAAATGTGTGTGTAGTTATCAGCAGATTGAGG
ATCATTCTCGTCCCACTCTCCGAATCTTGGAACTGCAGCTCCTCTATCAGACTGGTTGTCTTGCTTAACTTTGGACCTTCCAGGAGTACCGTGAC
TGCTATCATAAGAATTGTTCTTTCCTTCCCAAGCAGGAGATGCAACACCTCTTCCAGCATTACTAACCTTTGCCTGGTAATGTGGATGCAGCGGT
GATTTATCAAAGCTATGTTCAGATCCTATACTTTGTCTGCCAGTTCTACCAGAATTTGATCCACGACCACGTTGATGAGATGGCTCATTGGCACC
TTTCCTTCCCACATTCTCTTTACGAGCTGGAGAATTAGCATACTGGCGGAATTCACCNATCTCTTTACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E380062] SGN-U579628 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T973 [Download] [View] Facility Assigned ID: 240_C07_TUS03K7.Td_050.ab1
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0024 Quality Trim Threshold: 20.5