EST details — SGN-E410355

Search information 
Request: 410355Match: SGN-E410355
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C259320Clone name: PPI-16-F6
nocartOrdering Not Available
Library Name: PPIOrganism: Solanum tuberosum

Tissue: leaf
Development Stage: 6-week old leaf

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E410355Length: 220 bp (917 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E410355 [] (trimmed) AAACCCTAAAAATTCTTCATTCTACAAATTCAATCATCCCAATTTCGAATTTCCTTTTTTCTAACCCTAATTTCTCTTCCTTTCTATCCATGGAC
TTGGTTTATTCACCGATGGCCAAATGCATTTCAGCTCCGTTTCCTTCTTTCACTCATCGGCCACTTGCACTTTTTTCTAGGGTTTCCATTTCCCC
CAAATATGCAAATGCTCGTCGTTTGTGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E410355] SGN-U274024 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T257430 [Download][View] Facility Assigned ID: PPICL27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.905 Expected Error Rate: 0.0000 Quality Trim Threshold: 14.5