EST details — SGN-E430691

Search information 
Request: 430691Match: SGN-E430691
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278980Clone name: STM-54-I9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E430691Length: 468 bp (864 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E430691 [] (trimmed) GGGGAAAGAAGAACCCTTACGGCAAGTAATGCTAACTAGGTTTCACCTTTCCAATAAGATCAAACGCAGATGCATAGACAACTGAATTCAAAATT
TGGGAAACTGAAAATTCAATGTTACAAACATGGAGAAAATGACTACGAAAAACTACTAGGATCCAGGAGCCATCTCAAGGTTGGGCAGCCTCCAA
GAGTNTTTTCGATACTTGTCTAGCTGTCAAATCCTCCACTACAAGAAGCTTTGATTTGCTATTCCATCCTCTTTGGAGAGTCATCTGAGATAATT
TCAGACCCAGTACTCGGCCCATGAATTCCAGAAGTTCATTATTAGCTTCCCCACGAGCTGCAGGTGCGGTTACAGTGACCCGAACATCATCTGCA
TTCACTCTTGTAATTGCTGACCGCTGGGCACGGTCCTCGACTTCTATCGCCACTTGCACAAGGCCACCTTCTAACTGTGATATGCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E430691] SGN-U278543 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T282828 [Download] [View] Facility Assigned ID: STMIE53TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0129 Quality Trim Threshold: 20.5