EST details — SGN-E466871

Search information 
Request: 466871Match: SGN-E466871
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C252353Clone name: cPRO-26-I4
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E466871Length: 258 bp (925 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E466871 [] (trimmed) CTTCTCAAGAAGATGAGTGGTGCAATTTCTGTCGGGGGGAAAGGCCAAAAGAAGTTTGTCTACCTCCATAATTCATGTGCTGTACCAAGTGCTCC
CCCCATAACTATATTAAAAAGAGATAACAAAGGAAAAGGAACACCAGAGGGAAATGCCGATATTGTGACTGGGGTTGGATCTTCAGATGAATTCT
CTGATGATGAAAGAGGGACCATAAAAGAGCATGGGGGAAGCTGTGAGAAATCTAATATGGGTGAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E466871] SGN-U284356 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T252447 [Download][View] Facility Assigned ID: PRODX50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0285 Quality Trim Threshold: 14.5