EST details — SGN-E489006

Search information 
Request: 489006Match: SGN-E489006
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C282979Clone name: KS01011D02
nocartOrdering Not Available
Library Name: KS01Organism: Capsicum annuum

Tissue: leave
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E489006Length: 323 bp (851 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E489006 [] (trimmed) CGAATTTTTTGTTTGTGTGTCCAAATTCTTATATTCTTCTTTTTTTCGTCAGCCCTAGGGTTTCTCCATTTCTCCAAAGGTTTTTGCCTACTGAT
CCATTCTAAGCAGAGTGTTTGTAAGAAGGAAGTTTCCCGAGAATTTCTGGTTATTATTTTGAACTGTGCGCATTTGGATAGGATTAGAAGGGAAG
AAGAAAATTTTGATAATGAGGAACTCTCGCGCAGATTCTGCTGAGAATGTAGCCACTGATAATGTTGGGCCCATTGGCGGGACTGGAGCTTCTGC
TTCTACAAGGAGATCATCTTATGTGCCACCACATCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E489006] SGN-U197049 Capsicum annuum Build 1 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T289683 [Download][View] Facility Assigned ID: KS01011D02
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0207 Quality Trim Threshold: 14.5