EST details — SGN-E626278

Search information 
Request: 626278Match: SGN-E626278
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C426082Clone name: cccs18w6g1
nocartOrdering Not Available
Library Name: cccs18wOrganism: Coffea canephora

Tissue: Edorsperm and perisperm
Development Stage: 18 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E626278Length: 422 bp (567 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E626278 [] (trimmed) GGCCCCTTGGTCGTCCTATGGGTGGACCTCCTGGCGACCGCCCTCGCGGACCACCAAGGTTTGATGGGGATAGGCCCAGATTTGGTGACAGGGAG
GGATATCGTGCTGGTCCCCGTGGACCTCCTGGTGAGTTTGGTGGTGAGAAAGGTGGAGCTCCTGCCGATTACCAGCCTGCTTTCAGGGGTTCTGG
TGGAAGGCCTGGCTTTGGGCGTGGATCTGGAGGTTATGGTTCAGCACCACCAAGTTCAAGCTTCTCTTAGATTCATGTTTTGCTAATTATGCTAT
TTGCAATTTAGGCTCTCAGATGTTGCAGTTGAAAGTTATGCATGTTGAGATACGTAGTTGATTGAGACTCTATCTACAGTTTTGGTTGCTCTAGA
TCTTCAAATCAATCTAAGGAATTTCTTAAAAATATTTCTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E626278] SGN-U614149 Coffea canephora Build 3 16 ESTs assembled
[SGN-E626278] SGN-U637910 Coffee species Build 1 50 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T449945 [Download][View] Facility Assigned ID: cccs18w6g1.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15