EST details — SGN-E421842
| Search information |
| Request: 421842 | Match: SGN-E421842 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C273720 | Clone name: STM-33-D13 |
| ||
| Library Name: STM | Organism: Solanum tuberosum |
Tissue: mixed tissues
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E421842 | Length: 205 bp (1112 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E421842 [] (trimmed)
ATTGGAAGAGTGTGCATTATGGATGCCAACACGTCCTGGACTTGAGCTTCAGCTTTCTTACACTTTACGTGACCAAAATCCAGTTGGATTAACTG
TACCCATTCAACTTCCTGTAATCAATCAAGTTTTCGGTACAAATGATGTGGTGAAAATGTCACCGAATTCTGCTGTCGCGAGACTTGGACCTGCT
GGGAAATACATGCCT
TACCCATTCAACTTCCTGTAATCAATCAAGTTTTCGGTACAAATGATGTGGTGAAAATGTCACCGAATTCTGCTGTCGCGAGACTTGGACCTGCT
GGGAAATACATGCCT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E421842] | SGN-U289932 | Solanum tuberosum | Build 4 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T273979 [Download][View] | Facility Assigned ID: STMFA19TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.951 | Expected Error Rate: 0.0180 | Quality Trim Threshold: 14.5 |


