EST details — SGN-E421842

Search information 
Request: 421842Match: SGN-E421842
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273720Clone name: STM-33-D13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421842Length: 205 bp (1112 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E421842 [] (trimmed) ATTGGAAGAGTGTGCATTATGGATGCCAACACGTCCTGGACTTGAGCTTCAGCTTTCTTACACTTTACGTGACCAAAATCCAGTTGGATTAACTG
TACCCATTCAACTTCCTGTAATCAATCAAGTTTTCGGTACAAATGATGTGGTGAAAATGTCACCGAATTCTGCTGTCGCGAGACTTGGACCTGCT
GGGAAATACATGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421842] SGN-U289932 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273979 [Download][View] Facility Assigned ID: STMFA19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0180 Quality Trim Threshold: 14.5