EST details — SGN-E515559

Search information 
Request: 515559Match: SGN-E515559
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308919Clone name: cSML-13-C16
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308919 [cSML-13-C16] Trace: SGN-T316433 EST: SGN-E515560 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E515559Length: 287 bp (457 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E515559 [] (trimmed) GCACACACTGAAACTGAAAAAAAACATAGTAATAACATATTTATTTTAGAAAATCAATTGTGTTGTTTCAATTTGATTCTCAATGGCTTCAAAGA
TATTAATGATCAGTGTCTTTGTGTTGGATCTAATTGCTTTTGCTTTGGCTATTGCTGCTGAACAAAGACGAAGCACGGCGACCATTCAAACAGAT
AGCGAGCAAGTATATACCTATTGTGTCTATGACTCAGACATTTCAACTGGATATGGCGCTGGCGCCTTCTTATTTCTCATGGTGGGACAAATACT
TA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E515559] SGN-U206441 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T316432 [Download][View] Facility Assigned ID: cC-smflcSML13C16c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0157 Quality Trim Threshold: 20.5