Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E517778

Search information 
Request: 517778Match: SGN-E517778
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310178Clone name: cSML-3-D19
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310178 [cSML-3-D19] Trace: SGN-T318650 EST: SGN-E517777 Direction: 3' Facility: Cereon
Clone: SGN-C310178 [cSML-3-D19] Trace: SGN-T318652 EST: SGN-E517779 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517778Length: 229 bp (609 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E517778 [] (trimmed) TACATTAACTCCAAACGGCCGGAATAGTATGCCGGTTGAAGTAGCAAACGGAGTAACAGAAGCAATTGGTTATCCAAAAGGCGATTTGAGACCTC
AAAACCCTAACGCCGCCTCTAAGAAATCGAAGGAAAGCGAGCGACGCCGTAGGCGCAGGAAGCAGAAGAAGAACAAGGCGGCGTCGAAGGTCGCA
AATGGAGAAGACAGTGATAACGCTGCGCAAGACGGAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517778] SGN-U206931 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318651 [Download][View] Facility Assigned ID: cC-smflcSML3D19b1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0041 Quality Trim Threshold: 20.5