EST details — SGN-E543926

Search information 
Request: 543926Match: SGN-E543926
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192585Clone name: TUS-65-P23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93596 [cLEX-15-C22] Trace: SGN-T117734 EST: SGN-E305248 Direction: 5' Facility: TIGR
Clone: SGN-C192585 [TUS-65-P23] Trace: SGN-T344802 EST: SGN-E543927 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E543926Length: 531 bp (918 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E543926 [] (trimmed) ACTTTCCAATATTTTGGTTTTGAATACCACAAATCAAAACTTCTTCCCAAAACCTAAATGAATACCCAAATAGCAAAAACCTAATCTGGGTTCTC
AACTCGTTTTCCCTACAACAGCTCCTACTCATTTGGTTCCCTGAAAAATTCCCCCTATATAAAGCTCCAAACATGTCGGGAAAACCTCCGGAGGC
AAAACCCGCTTTTTTAACAGCTTTAAGTTGATGACAATGGCAATTTAATTTAAACCGGAAATGAGCCTCCCAATTGTACAATATCCCGGGGCAAA
TTGCCCCCTTGATGTCCCCACCTTTAATGCCGCTTTAAAATTCTAGTCGAGCTTCACCTTAAAATAAAAAAGGGGGTCCCTTGTGAGTGGCATGT
TGAGGAAAAAATAAATTCCTAATAGAGGGGCAATTATAAGCAAAAGTCCTGTAATCCCTGCAACAGTTCGTCTAACCAATATAACTTCTTCAACA
ACAGTTGAATTGGGTGAAGTTTGTGTTTCCTCCCCCCCGCGGGAAAATGGTTGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E543926] SGN-U594222 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T344801 [Download][View] Facility Assigned ID: TUS65P23_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0230 Quality Trim Threshold: 14.5