EST details — SGN-C183267

Search information 
Request: 183267Match: SGN-C183267
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C183267Clone name: TUS-41-L17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183267 is on microarray TOM1 spot ID 1-1-8.4.3.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76012 [cLES-16-I19] Trace: SGN-T100974 EST: SGN-E288248 Direction: 5' Facility: TIGR
Clone: SGN-C183267 [TUS-41-L17] Trace: SGN-T195188 EST: SGN-E393862 Direction: 3' Facility: INRA
Clone: SGN-C183267 [TUS-41-L17] Trace: SGN-T195821 EST: SGN-E394495 Direction: 3' Facility: INRA
Clone: SGN-C183267 [TUS-41-L17] Trace: SGN-T195821 EST: SGN-E398872 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394306Length: 379 bp (859 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394306 [] (trimmed) GGTCTTCTCTCCGATAACCGCAACTTTCTCAGAGTCTAACGGAATTTCTCTTTGAAACCCTAATAACAGTTACCTTAGTTGAGTTCTGTATACAA
TGGAAGAGGAAGTCCAAGTGGATGAGAATTTTCCCTTATTCTCCCGGAAAACTAAACCGGCCACAAAAAAACTCGTTCCTGCTCCAACCTCCATT
GAAGAAACCCCAAAGCAGCTTGACAAGGAGACTAACTCTGGTCCAACCCCTAGTTATATCACCTTCTCTGACTTAGGCCTCGCCGGGAGGGCTGT
ACAGACCTGTAATGAGCTGGGCATGAAAAAACCCACTCCTGTACAATATCACTGAATATCCCAGAATACTCTCCGGACAGGATGTGTTAGGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394306] SGN-U584582 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195632 [Download][View] Facility Assigned ID: FA0AAD29CF09RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0112 Quality Trim Threshold: 14.5