EST details — SGN-E277918

Search information 
Request: 277918Match: SGN-E277918
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59618Clone name: cLEL-5-P9
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277918Length: 283 bp (560 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E277918 [] (trimmed) GGCAAGCCCAAGATTGAATCCATCGAATAGGGCAGTATAAACCAATCAGGATTGTGAGATTTGCGATTGAGAATACAATCGAAGAGAGGATCTTA
AAGTTGCAAGAGAAAAAGGAGCTAGTATTTGAAGGGACGGTTGGTGGCTCTTCTGAGGCCTTGGGGAAACTAACAGAGGCAGATTTGAAGTTCTT
GGTTGTAACCTAAATTAGATTATGTTCTGTAACTTGGTTCAGCAAGAAAGATCATTTGATCTTTGCTTAGTTTCTTGCTTGAATCTTATCCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277918] SGN-U598486 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22050 [Download][View] Facility Assigned ID: tomato050389.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5