EST details — SGN-E390895

Search information 
Request: 390895Match: SGN-E390895
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185321Clone name: TUS-47-B7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185321 is on microarray TOM1 spot ID 1-1-2.2.10.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73435 [cLER-4-M22] Trace: SGN-T92817 EST: SGN-E277984 Direction: 5' Facility: TIGR
Clone: SGN-C185321 [TUS-47-B7] Trace: SGN-T192220 EST: SGN-E390894 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E390895Length: 458 bp (938 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E390895 [] (trimmed) GCAAAAGGAGGCAAGTGCATTGTTTTTACTCAAACTAAACGTGATGCTGATAAATTGTCGTATGTAATGCAAAAGAGTTTCAACTGTGAAGCTTT
GCACGGGGACATCTCACAAACCCAGAGGGAGAGAACTTTATCAGGTTTTCGCCAAGGTCAATTCAATGTTTTGGTGGCTACTGATGTTGCTGCTC
GAGGACTTGATGTACCTAATGTTGATCTGGTGGTACATTATGAGCTTCCAAACTCATCAGAGATCTTTGTTCATCGATCTGGTCGAACTGGGCGT
GCTGGGAAGAAAGGAAGTGCAATTCTGATTCATTCGTCAGGCCAACATAGGGATGTGAAAGGAATCGAACGTGATGTAGGATGCAGATTTATCGA
GCTTCCAAGGATAGAAGTAGAGGCTGGAGCAACAGACATGTTCAGTGACATGGGCAGAGGTGGGGGCCGCTTTGGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E390895] SGN-U571933 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192221 [Download][View] Facility Assigned ID: FA0AAD35CA04RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5