EST details — SGN-E391972

Search information 
Request: 391972Match: SGN-E391972
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C177978Clone name: TUS-27-P8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C177978 is on microarray TOM1 spot ID 1-1-1.4.6.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C64361 [cLEM-5-O3] Trace: SGN-T85181 EST: SGN-E271376 Direction: 5' Facility: TIGR
Clone: SGN-C177978 [TUS-27-P8] Trace: SGN-T193052 EST: SGN-E391726 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391972Length: 185 bp (963 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E391972 [] (trimmed) CAGGTCAAATGAAAATTACTAGACAAACATCAAGACAGCCAAAATACTAAACATTCAATCATGATCGACCTTTCGACAATTGTGTTATCACTTAA
AAAGAAAAAGTTAAAGATAACATAATAGTTTTGCATGCTACTATGCACGCAGACCATGAGAGAAAAAAATAACATTAAAGATGTTGGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391972] SGN-U602772 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193298 [Download][View] Facility Assigned ID: FA0AAD15DH04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.868 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5