EST details — SGN-E392040

Search information 
Request: 392040Match: SGN-E392040
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C176543Clone name: TUS-24-D13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C176543 is on microarray TOM1 spot ID 1-1-4.4.9.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26966 [cLEF-42-C13] Trace: SGN-T60531 EST: SGN-E247487 Direction: 5' Facility: TIGR
Clone: SGN-C176543 [TUS-24-D13] Trace: SGN-T193119 EST: SGN-E391793 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E392040Length: 599 bp (844 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E392040 [] (trimmed) GGCCAACAACGGGCAATGCAAGCTGATATTAGAGATTTCTTAAAGAAGTCTCTGGTGAATTGTTCTATAAAGAAAGCTATAATCTTCCACTTTTC
CATACACCTATCACGATGGCGTGGAGGAAAAAAAGGAAAAGCAAAAGTTACCCCTATTCCGTTTTACTGTAAATACTTCGCATGCTTCCCCTACA
GCCCAAATAACAGCTTTGGATGCTGCAGGAACAAATTATTTGGTCACCCCACTTCAAATTTGCTGCAAGCTCCAAAATTGAGCTCCCATCGTACA
CTGCTCCTGCCAGTTAAATTGGTAAGGCTTGTTCTTTATCTGCCGCGCATACTATTGTCACAATACTCGTCCAAATAGAATTCCACCAAAGATAA
ACGCACCAAACCATTTGTTGGAAACAAATTTCCTGTTGCAATCTGCACGAAATGACAGATCAACAATCCAAATTTGCCAAGCCATTTGGCCAGAA
GCAGCTGCCAAAAAGGCGTAATACGGCCATCCAATATCAGCATTAATTCCGGAAAGAGCAAGACTGCTGATGCATGCTAATCCAAACCCACTGAT
CCATTCTTTTGTGGAATCTCCAAATCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E392040] SGN-U583985 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T193366 [Download][View] Facility Assigned ID: FA0AAD12CB07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0156 Quality Trim Threshold: 14.5