EST details — SGN-E393829
| Search information |
| Request: 393829 | Match: SGN-E393829 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C172965 | Clone name: TUS-14-O11 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172965 is on microarray TOM1 spot ID 1-1-6.3.20.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C14380 [cLEC-7-L24] | Trace: SGN-T25505 | EST: SGN-E202223 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C172965 [TUS-14-O11] | Trace: SGN-T195154 | EST: SGN-E393828 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172965 [TUS-14-O11] | Trace: SGN-T195154 | EST: SGN-E398992 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172965 [TUS-14-O11] | Trace: SGN-T195608 | EST: SGN-E394282 | Direction: 5' | Facility: INRA |
| Clone: SGN-C172965 [TUS-14-O11] | Trace: SGN-T200196 | EST: SGN-E398993 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E393829 | Length: 103 bp (847 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E393829 [] (trimmed)
GGGGGGGTTGGGGGGGCAAATTACCCATTTTCGAATACCGGGATCAACTTTAAAAGAAAAAAGGAAGACAATTGGCAAAATTGAATAAAACCCCA
AAGCCCCA
AAGCCCCA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E393829] | SGN-U598126 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T195155 [Download][View] | Facility Assigned ID: FA0AAD2AH06FM2 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.812 | Expected Error Rate: 0.0432 | Quality Trim Threshold: 14.5 |
Working
