EST details — SGN-E398993

Search information 
Request: 398993Match: SGN-E398993
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172965Clone name: TUS-14-O11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172965 is on microarray TOM1 spot ID 1-1-6.3.20.8 [Order] [Tomato Microarray Database]
See unigene SGN-U584343 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C14380 [cLEC-7-L24] Trace: SGN-T25505 EST: SGN-E202223 Direction: 5' Facility: TIGR
Clone: SGN-C172965 [TUS-14-O11] Trace: SGN-T195154 EST: SGN-E393828 Direction: 3' Facility: INRA
Clone: SGN-C172965 [TUS-14-O11] Trace: SGN-T195154 EST: SGN-E398992 Direction: 3' Facility: INRA
Clone: SGN-C172965 [TUS-14-O11] Trace: SGN-T195155 EST: SGN-E393829 Direction: 3' Facility: INRA
Clone: SGN-C172965 [TUS-14-O11] Trace: SGN-T195608 EST: SGN-E394282 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398993Length: 443 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398993 [] (trimmed) ATTTTCTAAAGCTTCTGAAAAAGATCTTGAGTGCGTTTTCACAATAATGTGCAACCTTGTCAAGAAGCCTGAGAGCTTGGACCAAGTACATGAGA
TGGCAGAGCTCATATCCGCTAAAATCATTCAACAACCCAATGATAAACCCGCATTGCGCTTGAAAATCTTGTTCAATCTCTACAATCTGTTGGAG
AACCCATACAGCCGTTTCTGCGTTTACTTGAAGTCCCTCAAGTTGGCCACTGCCGGGAAGGTTACTGAACACATTTTGTCGTCCATCAAAATGAT
GGAATAACTTCTTGAAGGAGTGGAATCTTGGAGTCAAAGATCAGAGAGAGCTGTTTCTTGCAATCTCCAACATTTTAAAGGAAAGCAAAGGCTCT
ACAAACGATTCTTTCATGTTTCTTACAACGTATCTGGAAATCTATTCGCGGGGGGGGGGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398993] SGN-U584343 Tomato 200607 Build 2 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200196 [Download][View] Facility Assigned ID: FA0AAD2AH06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5