EST details — SGN-E439630

Search information 
Request: 439630Match: SGN-E439630
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C207114Clone name: cSTA-12-N10
nocartOrdering Not Available
Library Name: cSTAOrganism: Solanum tuberosum

Tissue: Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers
Development Stage: 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E439630Length: 409 bp (923 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E439630 [] (trimmed) TCCATGCCTTGCCCTTAGTGATTTTACTTCTCGCCAACTAAGGGTGATTAAAGCGGTCACTAAAAAGCATTTCAAAGATCTTGCCTATATCCGAG
TAGCAGGTGAAGCAACATCTCCACAGCAATTGATTGTCTATACAGATTCCAATTATGACAGAGATCTACTGATGAAAGAGGTGAAGGATGGCCTT
CGTAAAGAAGCGGAAATGAAGGTCGAATCTGCTGTTGGATTTCGACATGTCATTGATCTTCTTTCATCAGAGCGAAAGTTGATTGTCGGTCACAA
TTGCTTTCTTGATGTGGCGCATATGTACAGTAAATTCATTGGTCCACTACCTTCAACCGCTGAGGATTATGTATCTTCCCTTCAGAAGCTCTTTC
CTACCATAGTGGACACCAAGATACTCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E439630] SGN-U274468 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T204271 [Download][View] Facility Assigned ID: PSTBV77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5