EST details — SGN-C27627

Search information 
Request: 27627Match: SGN-C27627
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27627Clone name: cLEF-45-A16
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176693 is on microarray TOM1: SGN-S1-1-6.2.9.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176693 [TUS-24-J19] Trace: SGN-T193389 EST: SGN-E392063 Direction: 3' Facility: INRA
Clone: SGN-C176693 [TUS-24-J19] Trace: SGN-T197855 EST: SGN-E396529 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246521Length: 558 bp (874 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246521 [] (trimmed) GATACAGAATCCTGATATTCCCCCAGTTTTCAGCGGAACTAAGTTCCTTGTCTTGGATGAAGCACATAGAGTTCTAGACGTAGGCTTTGAAGAGG
AGTTGAGAGCAATCTTTCAGTGTTTGCCAAAGAATCGACAAACTCTTCTGTTTTCTGCAACAATGACTAGCAACCTGCAGACGCTACTTGAGCTT
TCTGCAAACAAAGCATATTTCTATGAGGCATATGAGGGATTCAAGACTGTAGAATCACTTAAGCAGCAGTACATTTTTATTCCGAAAAATGTGAA
GGATGTCTATCTGCAATACATTTTATCCAAAATCAAAGATATAGACGTTCGCTCTGCAATTATTTTTGTTTCCACCTGCAGGAGTTGTCAGCTTT
TGGGCTTGTTGTTGGAAGAACTCGAAATTGATGCTGCTGCATTGCATTCATACAAGTCCCAGTCACTGAGGCTTTCTGCTCTTCATAAATTCAAA
TCTGGGCAGGTCCCAATATTGGTCGCTACTGATGTCGCGAGTCGTGGTTTAAACATTCCAACAGTTGATCTGGTGGTAAATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246521] SGN-U584582 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61256 [Download][View] Facility Assigned ID: TMGGV08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5