EST details — SGN-C78157

Search information 
Request: 78157Match: SGN-C78157
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C78157Clone name: cLES-4-K15
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185452 is on microarray TOM1: SGN-S1-1-7.3.9.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185452 [TUS-47-G18] Trace: SGN-T192187 EST: SGN-E390861 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282224Length: 433 bp (825 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E282224 [] (trimmed) TTTATTACCTTTTTTAGACATCTTTAATTGAAGTACTTGTTTGTTCTCTCTTAAGGATCGGTTCGAAAGTTTAAGTTTGAGTTCTCTGTGATCTC
AATCAACAGATTTATTTGTTTTTGCTCTTCTAAAAAGCAGATTTCAATACTGATGACAACCTCCAACACACAACAAAGCTATGACAAAACAAGTG
AACTAAAAGCCTTTGATGACACAAAAGCAGGTGTCAAAGGACTTATTGATAGTGGAATTACTAAAGTACCTCAAATATTCATTCATCCAGAGGCC
TTAGAAAATAAAACCACAAATCCCAAAAATACACATTTCATTTTCCCTTTAATAGACCTCCAAAACATCAGCATTAACAACAAAGAGATAGTGAA
ACAAATTCAAGAAGCATCAGAGACATGGGGTTTCTTTCAAGTTATCAATCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282224] SGN-U579236 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97965 [Download][View] Facility Assigned ID: TPSAM68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5