Unigene SGN-U644984

Unigene Basic Information 
Unigene ID: SGN-U644984
Unigene Build: Coffee species #1
Date: 2010-04-19
Organism: C.canephora
C.arabica
Alternative ID: none
mRNA sequence: Length: 57 bp

>SGN-U644984 Coffee species #1 (1 members)
GCTTGGATGTTGAATACATATGAATAGCCTAAGAAGGCTATTATCTTATCCAAGTAA

[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E629596
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (0)None