Sol Genomics Network

Unigene SGN-U205490

Unigene Basic Information

Unigene ID:	SGN-U205490
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	205490
mRNA sequence:	Length: 674 bp

>SGN-U205490 Capsicum annuum #1 (1 members)
TTCAGCTGAATAGCTTGCTCCTGCTTTTCTCTACTCTCCATCAATCTAGTGTTAATCATGCTCGCTGCTAGACTTTTTGGGAGGACATTT
TTGGCGGCGGCAAAATCAGAGAGTTCAGCCGCTGCAGCAGCTGCTTCTTCTGCTGCTACTGATAAAGCCTTTAATCCACTTGAGCAGTTC
TTTGAATTGGATAGAACTCCAGAGGATGATAAGCCTGTTGTCTATGGTCGAGGTTGGAAGGCTTCTGAACTGCGTTTGAAGTCTTGGGAT
GATCTGCAGAAGTTATGGTATGTTCTTCTGAAGGAAAAGAACATGTTGATGACTCAACGCCAGATGCTTAATGCTCAGAACCTGCGTTTT
CCTAATCCAGAGCGTATTTCCAAGGTAAGGAAGTCGATGTGCCGAATCAAGCATGTTCTTACTGAGAGAGCAATTGATGAAGCAGATCCA
AGGAGGTCAGCTGAAATGAAGAGGATGATAAATGCTCTCTAATTTTCATTCGGTAGTAGTGTTTATATACCCTTGTAATCAGCATTTCGA
TTTACCTCTTTTCTATTAGCTCCACATGTCGGGAAATCACCTTTTATGATAGTAAACTCTATGGACTAGTTCACTAGGATGTAATGGAGA
TTGGCAATTTTGGTTTGAAAGATTTGATCGTGCTGAAAATAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS01	leave	6599	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E494478
[Show Image]

Markers Information (1)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	3427	Ribosomal_L29	5
2	26472	Ribosomal_L29	5
5	60484	Ribosomal_L29	5
1.1	103717	Ribosomal protein L47 mitochondrial - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: mitochondrial ribosome (GO:0005761) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L29 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	5
2	122033	Ribosomal protein L29 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L47 mitochondrial - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: mitochondrial ribosome (GO:0005761) - Biological Process: protein biosynthesis (GO:0006412)	5
5	132243	Ribosomal protein L29 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L47 mitochondrial - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: mitochondrial ribosome (GO:0005761) - Biological Process: protein biosynthesis (GO:0006412)	5

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: