Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U572048 in the current build, Tomato 200607 #2
Unigene SGN-U236124

Unigene Basic Information 
Unigene ID: SGN-U236124
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 236124
mRNA sequence: Length: 740 bp

>SGN-U236124 Lycopersicon Combined #3 (1 members)
TGCTTTTAACGCCGAGCTGTAAAGAGCGGTGAAGACACCGGAGCGAAGAAATGGTATCTAAAAGCTCCGTTTTGGAGCAAAGATTCGAAC
TCTGAATCTCAGACGGAATCTCCGTCGGCGGTGGCGGAGCTAATAAGCTCTCTTGAACGACAGAGACTATACAGGGAGGTGACACTCGCA
CTCCGCACAGGACTCAATGATGCACGTGCTGAGTTCTCCTTCCTCCGTATTCGCGGCCTCCGCGTCATCCTCAAGTTCCTCCGATCCGTT
GCCGAGTCAGATACTACCATCAACATCTTCTGTCACAGCCAATCCATTCCCGATCTTCAAGTGGTTCCAGTTCTTTTCAGACATTCCTTG
AGAGATACAGAGGACCAGAATGTTACCAGTCTAGACCACATATTTACTGTGGAACCTATGGAAATAACCAGCCCGTCAACTGATTCTGAA
GTTTCTCTAGCGCTTAGAGTTCTGGAAGGTTGTTGTCTGATTCATTGCGAGAGTAATGTTTTGGCCCATCAGTACAAGGCAATCCCCGGT
GTTGATGAACATACTGTCGACTCGAGGGGTACTGGGACAAGGAGCATGCTTGGATGCTTTTATTGCTATCATGCTGGATTCATCTGCCAA
TCAGGCGGATTTTGAGGCTTGCAATGGCATTGANGGAAGTTGCCATACTCATTAGAGACAAACAAGTAGATGAAAAATTGAGGCTCAGTG
TGGGAGAGTTTCTACTGCTT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E345714
[Show Image]
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)