Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U291019

Unigene Basic Information

Unigene ID:	SGN-U291019
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	291019
mRNA sequence:	Length: 498 bp

>SGN-U291019 Solanum tuberosum #4 (1 members)
CAAAACTCTACTTTCCCTTAATTAAGTGTATCTAAGCTTGTTTTTTTGAGTGTAGAGGAAAATGCAAGAGCAAGCGACAAGTTCTATTGC
CGCTAGTTCACTACCTTCAAGTAGTGAGAGATCTTCTAGTTCAGCTTTACATCTTGAACTCAAAGAAGGTATGGAGAGTGATGATGAGAT
CAGAAGAGTACCGGAGATGGGCGGAGAAGCGACGGGAACGATGTCAGCTTCTGGCAGAGATGGAGCTTCGGCCGCCGGTCAAGCTCAACC
ATCAGCTGGGACTCAGAGGAAGAGAGGAAGAAGCCCAGCTGACAAAGAAAACAAAAGGTTAAAAAGGTTGTTGAGAAATAGAGTGTCAGC
ACAGCAAGCAAGGGAGAGGAAGAAAGCATATTTGATAGATCTGGAAGCAAGGGTGAAGGAATTGGAAACAAAGAATGCAGAACTTGAAGA
GAGGTTGTCTACATTGCAAAATGAGAACCAAATGCTTAGACATATACT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTD	dormant tuber one month post harvest	5045	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E482038
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	32	TF_bZIP	291
2	22207	TF_bZIP	45
5	63145	Leuzip_CREB TF_bZIP	3
1.1	101428	Basic-leucine zipper (bZIP) transcription factor - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565) - Molecular Function: protein dimerization activity (GO:0046983)	192
2	123470	Eukaryotic transcription factor DNA-binding Basic-leucine zipper (bZIP) transcription factor - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565) - Molecular Function: protein dimerization activity (GO:0046983)	4
5	135320	Eukaryotic transcription factor DNA-binding bZIP transcription factor bZIP_1 - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565) - Molecular Function: protein dimerization activity (GO:0046983) cAMP response element binding (CREB) protein - Molecular Function: DNA binding (GO:0003677) - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) Basic-leucine zipper (bZIP) transcription factor - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565) - Molecular Function: protein dimerization activity (GO:0046983)	3

Preceding Unigenes (1)

Unigene	Build
SGN-U265813	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: